Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 5165335
End position: 5165358
Length: 24

DNA sequence
>NC_017904, from 5165335 to 5165358 (24 bp); Mycobacterium sp. MOTT36Y CGATCGCGAGCGCGATCTCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5164101-5166314	Sequence	W7S_23750 - hypothetical protein (Protein is coded in complementary strand; from 5166314 to 5164101)