Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 5180449
End position: 5180475
Length: 27

DNA sequence
>NC_017904, from 5180449 to 5180475 (27 bp); Mycobacterium sp. MOTT36Y GCCGGCGGCGCCTGCGGCGCCGGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5179729-5180556	Sequence	W7S_23830 - glycosyl hydrolase family protein 16 (Protein is coded in complementary strand; from 5180556 to 5179729)