Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 5309240
End position: 5309264
Length: 25

DNA sequence
>NC_017904, from 5309240 to 5309264 (25 bp); Mycobacterium sp. MOTT36Y CCGCGTCGCGCAGCGCCGCGACGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5308927-5310240	Sequence	W7S_24430 - amidohydrolase family protein (Protein is coded in complementary strand; from 5310240 to 5308927)