Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 5335646
End position: 5335669
Length: 24

DNA sequence
>NC_017904, from 5335646 to 5335669 (24 bp); Mycobacterium sp. MOTT36Y TCGGCGTCGTCGCCGGCGTCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5335019-5335714	Sequence	W7S_24530 - hypothetical protein (Protein is coded in complementary strand; from 5335714 to 5335019)