Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 5409863
End position: 5409886
Length: 24

DNA sequence
>NC_017904, from 5409863 to 5409886 (24 bp); Mycobacterium sp. MOTT36Y GCCGGCGCCGGTGCCGTCGCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5409144-5410007	Sequence	W7S_24900 - short-chain dehydrogenase/reductase SDR (Protein is coded in complementary strand; from 5410007 to 5409144)