Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 795609
End position: 795653
Length: 45

DNA sequence
>NC_017904, from 795609 to 795653 (45 bp); Mycobacterium sp. MOTT36Y GCTTCCTCGGCGGCCTTCTCCTCGGCGGCCTTGTCCTCGGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 794964-795842	Sequence	W7S_03980 - hypothetical protein (Protein is coded in complementary strand; from 795842 to 794964)