Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 857277
End position: 857300
Length: 24

DNA sequence
>NC_017904, from 857277 to 857300 (24 bp); Mycobacterium sp. MOTT36Y CGGCGACGGTGACGGCCACGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 856496-858109	Sequence	W7S_04310 - hypothetical protein (Protein is coded in complementary strand; from 858109 to 856496)