Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 862832
End position: 862855
Length: 24

DNA sequence
>NC_017904, from 862832 to 862855 (24 bp); Mycobacterium sp. MOTT36Y CGTCGACGTCGTCGGCGAAGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 862669-863799	Sequence	W7S_04350 - phosphoserine aminotransferase (Protein is coded in complementary strand; from 863799 to 862669)