Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 1432839
End position: 1432862
Length: 24

DNA sequence
>NC_018289, from 1432839 to 1432862 (24 bp); Mycobacterium smegmatis str. MC2 155 ATCGTCGTCGTCCTCGTCATCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1432765-1433625	Sequence	MSMEI_1294 - exported protein (Protein is coded in complementary strand; from 1433625 to 1432765)