Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 168953
End position: 168976
Length: 24

DNA sequence
>NC_018289, from 168953 to 168976 (24 bp); Mycobacterium smegmatis str. MC2 155 GGTGTCGGTGGCGGTTTCGGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 168219-170087	Sequence	MSMEI_0142 - hypothetical protein (Protein is coded in complementary strand; from 170087 to 168219)