Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 1713392
End position: 1713415
Length: 24

DNA sequence
>NC_018289, from 1713392 to 1713415 (24 bp); Mycobacterium smegmatis str. MC2 155 GTCGAAGTGGAACTCGAAGTAGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1713126-1714187	Sequence	MSMEI_1584 iunH inosine-uridine nucleoside hydrolase, IunH (Protein is coded in complementary strand; from 1714187 to 1713126)