Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 1929837
End position: 1929860
Length: 24

DNA sequence
>NC_018289, from 1929837 to 1929860 (24 bp); Mycobacterium smegmatis str. MC2 155 GGCGGCGACGGCGGCGTCGGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1928737-1930017	Sequence	MSMEI_1811 - L-seryl-tRNA(Sec) selenium transferase (Protein is coded in complementary strand; from 1930017 to 1928737)