Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2132848
End position: 2132871
Length: 24

DNA sequence
>NC_018289, from 2132848 to 2132871 (24 bp); Mycobacterium smegmatis str. MC2 155 GGCGACGGCGATGCCGACCGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2132528-2134417	Sequence	MSMEI_2007 nuoL NADH-quinone oxidoreductase chain l (Protein is coded in complementary strand; from 2134417 to 2132528)