Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 227650
End position: 227673
Length: 24

DNA sequence
>NC_018289, from 227650 to 227673 (24 bp); Mycobacterium smegmatis str. MC2 155 CGGCCTCGGCCTCGGTCTCGACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 226770-229322	Sequence	MSMEI_0195 - AAA ATPase containing von Willebrand factor type A (VWA) domain-like protein