Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2574705
End position: 2574728
Length: 24

DNA sequence
>NC_018289, from 2574705 to 2574728 (24 bp); Mycobacterium smegmatis str. MC2 155 TGCCGTCGCCGTTGCCGTTGCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2574650-2575372	Sequence	MSMEI_2429 - GntR family transcriptional regulator (Protein is coded in complementary strand; from 2575372 to 2574650)