Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2642423
End position: 2642446
Length: 24

DNA sequence
>NC_018289, from 2642423 to 2642446 (24 bp); Mycobacterium smegmatis str. MC2 155 CCGCGGCCTCGGCCTCGGCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2641405-2643654	Sequence	MSMEI_2496 - glycoside hydrolase family 3 domain protein (Protein is coded in complementary strand; from 2643654 to 2641405)