Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2703000
End position: 2703023
Length: 24

DNA sequence
>NC_018289, from 2703000 to 2703023 (24 bp); Mycobacterium smegmatis str. MC2 155 ATCGGCATGGGCATCGGCCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2702017-2703564	Sequence	MSMEI_2557 efpA integral membrane efflux protein EfpA