Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2796248
End position: 2796271
Length: 24

DNA sequence
>NC_018289, from 2796248 to 2796271 (24 bp); Mycobacterium smegmatis str. MC2 155 AGCGCCAGCCCCAGGGCCAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2795618-2796409	Sequence	MSMEI_2658 - glutamate ABC transporter permease (Protein is coded in complementary strand; from 2796409 to 2795618)