Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2797929
End position: 2797952
Length: 24

DNA sequence
>NC_018289, from 2797929 to 2797952 (24 bp); Mycobacterium smegmatis str. MC2 155 GTCGCTGTCGCCGCCGCTGTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2797213-2798034	Sequence	MSMEI_2660 - glutamate binding periplasmic protein (Protein is coded in complementary strand; from 2798034 to 2797213)