Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 3594824
End position: 3594847
Length: 24

DNA sequence
>NC_018289, from 3594824 to 3594847 (24 bp); Mycobacterium smegmatis str. MC2 155 GTCGACGTCGGCGTCGAGGTCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3593979-3595409	Sequence	MSMEI_3451 - hypothetical protein (Protein is coded in complementary strand; from 3595409 to 3593979)