Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 3751397
End position: 3751420
Length: 24

DNA sequence
>NC_018289, from 3751397 to 3751420 (24 bp); Mycobacterium smegmatis str. MC2 155 CGGTCTCGGTGTCGGTTTCGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3750904-3751773	Sequence	MSMEI_3597 - Nuclear transport factor 2 (Protein is coded in complementary strand; from 3751773 to 3750904)