Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 3885518
End position: 3885541
Length: 24

DNA sequence
>NC_018289, from 3885518 to 3885541 (24 bp); Mycobacterium smegmatis str. MC2 155 CTCACTCAGTCACTCACTCACTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3885341-3885523	Sequence	MSMEI_3725 - hypothetical protein (Protein is coded in complementary strand; from 3885523 to 3885341)