Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4109247
End position: 4109270
Length: 24

DNA sequence
>NC_018289, from 4109247 to 4109270 (24 bp); Mycobacterium smegmatis str. MC2 155 GCGCGGGCGCGGGAGCGGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4108529-4110178	Sequence	MSMEI_3941 - AMP-dependent synthetase and ligase (Protein is coded in complementary strand; from 4110178 to 4108529)