Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4127474
End position: 4127497
Length: 24

DNA sequence
>NC_018289, from 4127474 to 4127497 (24 bp); Mycobacterium smegmatis str. MC2 155 GTCGGCGTCTGCGTCGGCGTAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4125720-4128464	Sequence	MSMEI_3956 - hypothetical protein (Protein is coded in complementary strand; from 4128464 to 4125720)