Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4310575
End position: 4310598
Length: 24

DNA sequence
>NC_018289, from 4310575 to 4310598 (24 bp); Mycobacterium smegmatis str. MC2 155 GGCCTTGGGCTTGGCCTTGGCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4310303-4312009	Sequence	MSMEI_4128 - cell division protein FtsW (Protein is coded in complementary strand; from 4312009 to 4310303)