Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4466044
End position: 4466067
Length: 24

DNA sequence
>NC_018289, from 4466044 to 4466067 (24 bp); Mycobacterium smegmatis str. MC2 155 GAACGCGAATGCAAACGCAAACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4464656-4466134	Sequence	MSMEI_4273 - amino acid permease-associated region (Protein is coded in complementary strand; from 4466134 to 4464656)