Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4545640
End position: 4545663
Length: 24

DNA sequence
>NC_018289, from 4545640 to 4545663 (24 bp); Mycobacterium smegmatis str. MC2 155 ACCACGGCCACGATCACGAACACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4545037-4545723	Sequence	MSMEI_4352 - hypothetical protein (Protein is coded in complementary strand; from 4545723 to 4545037)