Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4873957
End position: 4873980
Length: 24

DNA sequence
>NC_018289, from 4873957 to 4873980 (24 bp); Mycobacterium smegmatis str. MC2 155 GGTGCGTGTGCGGGCGCGGGTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4873450-4874052	Sequence	MSMEI_4648 - Twin-arginine translocation pathway signal (Protein is coded in complementary strand; from 4874052 to 4873450)