Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 51870
End position: 51893
Length: 24

DNA sequence
>NC_018289, from 51870 to 51893 (24 bp); Mycobacterium smegmatis str. MC2 155 CACGATCAGGATCGCGATCACGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 51700-52959	Sequence	MSMEI_0032 pknA serine/threonine-protein kinases pknA (Protein is coded in complementary strand; from 52959 to 51700)