Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5606818
End position: 5606841
Length: 24

DNA sequence
>NC_018289, from 5606818 to 5606841 (24 bp); Mycobacterium smegmatis str. MC2 155 CGGGTTCGGGTTCGGGCTCGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5606538-5608001	Sequence	MSMEI_5365 - hypothetical protein (Protein is coded in complementary strand; from 5608001 to 5606538)