Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5729220
End position: 5729243
Length: 24

DNA sequence
>NC_018289, from 5729220 to 5729243 (24 bp); Mycobacterium smegmatis str. MC2 155 CCGTCGTCGTCGCGGTCGCCGTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5728302-5730428	Sequence	MSMEI_5490 - amylo-alpha-1,6-glucosidase (Protein is coded in complementary strand; from 5730428 to 5728302)