Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5836526
End position: 5836549
Length: 24

DNA sequence
>NC_018289, from 5836526 to 5836549 (24 bp); Mycobacterium smegmatis str. MC2 155 GCGCTCGGGCTCGGGCTCGGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5836290-5837441	Sequence	MSMEI_5606 - pe-PPE, C-terminal domain protein (Protein is coded in complementary strand; from 5837441 to 5836290)