Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5853305
End position: 5853328
Length: 24

DNA sequence
>NC_018289, from 5853305 to 5853328 (24 bp); Mycobacterium smegmatis str. MC2 155 GTGACGCCGTGACGCCGTGACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 5852343-5853317	Sequence	MSMEI_5625 - alcohol dehydrogenase, zinc-binding protein