Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5860639
End position: 5860662
Length: 24

DNA sequence
>NC_018289, from 5860639 to 5860662 (24 bp); Mycobacterium smegmatis str. MC2 155 GTTGTTGCTGTTGTTGTTGTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5860579-5860776	Sequence	MSMEI_5634 - hypothetical protein (Protein is coded in complementary strand; from 5860776 to 5860579)