Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 5890603
End position: 5890626
Length: 24

DNA sequence
>NC_018289, from 5890603 to 5890626 (24 bp); Mycobacterium smegmatis str. MC2 155 CACCACCAGCACCACCACGACCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5889443-5891173	Sequence	MSMEI_5665 - hypothetical protein (Protein is coded in complementary strand; from 5891173 to 5889443)