Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6147083
End position: 6147106
Length: 24

DNA sequence
>NC_018289, from 6147083 to 6147106 (24 bp); Mycobacterium smegmatis str. MC2 155 GTCGGCGTGGGCGTGGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6146585-6147370	Sequence	MSMEI_5921 - hypothetical protein (Protein is coded in complementary strand; from 6147370 to 6146585)