Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6186421
End position: 6186444
Length: 24

DNA sequence
>NC_018289, from 6186421 to 6186444 (24 bp); Mycobacterium smegmatis str. MC2 155 TGTCGAGGTCGATGTCGGTGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6185652-6186638	Sequence	MSMEI_5963 - binding-protein-dependent transport system inner membrane protein (Protein is coded in complementary strand; from 6186638 to 6185652)