Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6271430
End position: 6271453
Length: 24

DNA sequence
>NC_018289, from 6271430 to 6271453 (24 bp); Mycobacterium smegmatis str. MC2 155 ACCGCCTCCGCCGCCGCCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6269005-6271458	Sequence	MSMEI_6040 pon1 bifunctional membrane-associated penicillin-binding protein 1A/1B ponA2 : penicillin-insensitive transglycosylase + penicillin-sensitive transpeptidase