Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6274470
End position: 6274493
Length: 24

DNA sequence
>NC_018289, from 6274470 to 6274493 (24 bp); Mycobacterium smegmatis str. MC2 155 CCGGGTCCCGGTCCCGGTCCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6274407-6275630	Sequence	MSMEI_6045 - serine/threonine-protein kinase (Protein is coded in complementary strand; from 6275630 to 6274407)