Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6333674
End position: 6333697
Length: 24

DNA sequence
>NC_018289, from 6333674 to 6333697 (24 bp); Mycobacterium smegmatis str. MC2 155 ACCACGACCACGACCACGACCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6333665-6334375	Sequence	MSMEI_6105 - Thiocyanate hydrolase subunit gamma