Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6617536
End position: 6617559
Length: 24

DNA sequence
>NC_018289, from 6617536 to 6617559 (24 bp); Mycobacterium smegmatis str. MC2 155 GTCGTAGCCGTACTCGTAGGCGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6616859-6618079	Sequence	MSMEI_6384 - Nonspecific lipid-transfer protein (Protein is coded in complementary strand; from 6618079 to 6616859)