Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 75530
End position: 75553
Length: 24

DNA sequence
>NC_018289, from 75530 to 75553 (24 bp); Mycobacterium smegmatis str. MC2 155 CGGCGGCGGCGGAGGCGGCGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 74430-75818	Sequence	MSMEI_0055 - hypothetical protein (Protein is coded in complementary strand; from 75818 to 74430)