Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 6391870
End position: 6391894
Length: 25

DNA sequence
>NC_018289, from 6391870 to 6391894 (25 bp); Mycobacterium smegmatis str. MC2 155 GCGCCGCGACGCGGCGGGCCCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6391221-6392585	Sequence	MSMEI_6156 - diacylglycerol O-acyltransferase (Protein is coded in complementary strand; from 6392585 to 6391221)