Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 1011416
End position: 1011442
Length: 27

DNA sequence
>NC_018289, from 1011416 to 1011442 (27 bp); Mycobacterium smegmatis str. MC2 155 TCGAGCGCGTCGAGCGCATCGCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1010636-1011727	Sequence	MSMEI_0906 murB UDP-N-acetylenolpyruvoylglucosamine reductase MurB