Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 1238308
End position: 1238334
Length: 27

DNA sequence
>NC_018289, from 1238308 to 1238334 (27 bp); Mycobacterium smegmatis str. MC2 155 GACGTCAAGGACGTCAAGGACGTCAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1237019-1238542	Sequence	MSMEI_1145 - pe-PPE, C-terminal domain protein