Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 2269266
End position: 2269292
Length: 27

DNA sequence
>NC_018289, from 2269266 to 2269292 (27 bp); Mycobacterium smegmatis str. MC2 155 ATAGGCTCTATAGCCTCTATAGGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2267600-2269270	Sequence	MSMEI_2135 - Urea amidolyase, allophanate hydrolase subunit
ORF. 2269218-2270210	Sequence	MSMEI_2136 - integral membrane protein (Protein is coded in complementary strand; from 2270210 to 2269218)