Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 252671
End position: 252697
Length: 27

DNA sequence
>NC_018289, from 252671 to 252697 (27 bp); Mycobacterium smegmatis str. MC2 155 CATCATGGTCTTCATGGTCTTCATGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 251730-254627	Sequence	MSMEI_0218 mmpL5 transmembrane transport protein MmpL1 (Protein is coded in complementary strand; from 254627 to 251730)