Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 282549
End position: 282575
Length: 27

DNA sequence
>NC_018289, from 282549 to 282575 (27 bp); Mycobacterium smegmatis str. MC2 155 CTGCGGCGGCTGAGGCGGCTGAGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 281992-285033	Sequence	MSMEI_0243 mmpL3 Drug exporters of the RND superfamily-like protein (Protein is coded in complementary strand; from 285033 to 281992)