Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4296466
End position: 4296492
Length: 27

DNA sequence
>NC_018289, from 4296466 to 4296492 (27 bp); Mycobacterium smegmatis str. MC2 155 GACATCGCCGAGATCGCCGACCTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4295798-4297477	Sequence	MSMEI_4113 - Signal transduction histidine kinase regulating citrate/malate metabolism