Sequence retrieval

Genome: Mycobacterium smegmatis str. MC2 155
Start position: 4711948
End position: 4711974
Length: 27

DNA sequence
>NC_018289, from 4711948 to 4711974 (27 bp); Mycobacterium smegmatis str. MC2 155 CTCGTGGTCCTCGTGGTCCTCGTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4711499-4714612	Sequence	MSMEI_4509 - ribonuclease, Rne/Rng family (Protein is coded in complementary strand; from 4714612 to 4711499)